-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31305 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAdEasy
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 33000
-
Vector typeAdenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMesothelin
-
Alt nameMsln
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1850
-
Entrez GeneMSLN (a.k.a. MPF, SMRP)
-
Tags
/ Fusion Proteins
- Flag (C terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CGCGTTTTCATCATTGTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Msln Promoter sequence provided by author (see above link)
Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid.
Msln-1F: TCATTTGTTCCCTTTGACGGC
Msln-1R: CTCTCCCCAGCATCCACATTC
Expect 987 nt product
Msln-2F: TTGCCTACAACACCCTGCTGCG
Msln-2R: GCTCACAATGCTTCCATCAAACG
Expect 792 nt product
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAdEasy-Msln-iCre-HA-Flag was a gift from William Pu (Addgene plasmid # 31305 ; http://n2t.net/addgene:31305 ; RRID:Addgene_31305) -
For your References section:
Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. Zhou B, Honor LB, He H, Ma Q, Oh JH, Butterfield C, Lin RZ, Melero-Martin JM, Dolmatova E, Duffy HS, Gise A, Zhou P, Hu YW, Wang G, Zhang B, Wang L, Hall JL, Moses MA, McGowan FX, Pu WT. J Clin Invest. 2011 May 2. 121(5):1894-904. 10.1172/JCI45529 PubMed 21505261