pRLCon1-249_SNP
(Plasmid
#31454)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRL-Con
- Backbone size w/o insert (bp) 6380
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHNF4A 3'UTR fragment
-
SpeciesH. sapiens (human)
-
Insert Size (bp)249
-
MutationSNP rs11574744 in miR-34a binding site
-
Entrez GeneHNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer taacaccgagttcgtgaaggtg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To measure regulatory potential of 3'UTR. miR-34a site destroyed.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRLCon1-249_SNP was a gift from Gerhart Ryffel (Addgene plasmid # 31454 ; http://n2t.net/addgene:31454 ; RRID:Addgene_31454) -
For your References section:
A systematic analysis of the 3'UTR of HNF4A mRNA reveals an interplay of regulatory elements including miRNA target sites. Wirsing A, Senkel S, Klein-Hitpass L, Ryffel GU. PLoS One. 2011;6(11):e27438. Epub 2011 Nov 30. 10.1371/journal.pone.0027438 PubMed 22140441