pQStrep2-GADD45G
(Plasmid
#31584)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQStrep2
- Backbone size w/o insert (bp) 3460
-
Modifications to backboneGenBank: AY028642
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegrowth arrest and DNA-damage-inducible, gamma
-
Alt namePSFEp758F0111
-
SpeciesH. sapiens (human)
-
Insert Size (bp)546
-
GenBank IDDQ000504
-
Entrez GeneGADD45G (a.k.a. CR6, DDIT2, GADD45gamma, GRP17)
-
Tags
/ Fusion Proteins
- His (N terminal on backbone)
- Strep (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
- 3′ sequencing primer GGCAACCGAGCGTTCTGAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that Addgene's quality control sequence shows a small deletion in the vector region downstream of insert; the deletion does not affect any features in this construct.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQStrep2-GADD45G was a gift from Konrad Buessow (Addgene plasmid # 31584 ; http://n2t.net/addgene:31584 ; RRID:Addgene_31584) -
For your References section:
Structural genomics of human proteins--target selection and generation of a public catalogue of expression clones. Bussow K, Scheich C, Sievert V, Harttig U, Schultz J, Simon B, Bork P, Lehrach H, Heinemann U. Microb Cell Fact. 2005 Jul 5. 4():21. 10.1186/1475-2859-4-21 PubMed 15998469