pQStrep2-PREI3
(Plasmid
#31592)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepQStrep2
- Backbone size w/o insert (bp) 3460
-
Modifications to backboneGenBank: AY028642
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepreimplantation protein 3
-
Alt namePSFEp758B0812
-
Alt namePREI3
-
Alt nameCGI-95
-
SpeciesH. sapiens (human)
-
Insert Size (bp)744
-
GenBank IDDQ000500
-
Entrez GeneMOB4 (a.k.a. 2C4D, CGI-95, MOB1, MOB3, MOBKL3, PHOCN, PREI3)
-
Tags
/ Fusion Proteins
- His (N terminal on backbone)
- StrepII-tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
- 3′ sequencing primer GGCAACCGAGCGTTCTGAAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there is a small gap between Addgene's quality control sequence and the reference sequence provided by the depositor. The gap is downstream of the ORF and should not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQStrep2-PREI3 was a gift from Konrad Buessow (Addgene plasmid # 31592 ; http://n2t.net/addgene:31592 ; RRID:Addgene_31592) -
For your References section:
Structural genomics of human proteins--target selection and generation of a public catalogue of expression clones. Bussow K, Scheich C, Sievert V, Harttig U, Schultz J, Simon B, Bork P, Lehrach H, Heinemann U. Microb Cell Fact. 2005 Jul 5;4:21. doi: 10.1186/1475-2859-4-21. 10.1186/1475-2859-4-21 PubMed 15998469