Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

phASCL1-N106
(Plasmid #31781)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31781 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    N106
  • Backbone manufacturer
    home made/Crabtree lab
  • Backbone size w/o insert (bp) 8455
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    achaete-scute complex homolog 1
  • Alt name
    ASCL1
  • Species
    H. sapiens (human)
  • Entrez Gene
    ASCL1 (a.k.a. ASH1, HASH1, MASH1, bHLHa46)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggcacttgatgtaattctccttg
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phASCL1-N106 was a gift from Jerry Crabtree (Addgene plasmid # 31781 ; http://n2t.net/addgene:31781 ; RRID:Addgene_31781)
  • For your References section:

    MicroRNA-mediated conversion of human fibroblasts to neurons. Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer C, Dolmetsch RE, Tsien RW, Crabtree GR. Nature. 2011 Jul 13. doi: 10.1038/nature10323. 10.1038/nature10323 PubMed 21753754