Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLSSmKate2-N1
(Plasmid #31867)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31867 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3998
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LSS-mKate2
  • Insert Size (bp)
    717
  • Mutation
    K69Y/P131T/S148G/M167D/T183S/M196V
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLSSmKate2-N1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31867 ; http://n2t.net/addgene:31867 ; RRID:Addgene_31867)
  • For your References section:

    Monomeric red fluorescent proteins with a large Stokes shift. Piatkevich KD, Hulit J, Subach OM, Wu B, Abdulla A, Segall JE, Verkhusha VV. Proc Natl Acad Sci U S A. 2010 Mar 23;107(12):5369-74. Epub 2010 Mar 8. 10.1073/pnas.0914365107 PubMed 20212155