Skip to main content

pTight-hASCL1-N174
(Plasmid #31876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31876 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTight-N174
  • Backbone manufacturer
    home made/Crabtree lab
  • Backbone size w/o insert (bp) 7998
  • Vector type
    Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    achaete-scute complex homolog 1
  • Alt name
    ASCL1
  • Species
    H. sapiens (human)
  • Entrez Gene
    ASCL1 (a.k.a. ASH1, HASH1, MASH1, bHLHa46)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer atgtcgaggtaggcgtgtac
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTight-hASCL1-N174 was a gift from Jerry Crabtree (Addgene plasmid # 31876 ; http://n2t.net/addgene:31876 ; RRID:Addgene_31876)
  • For your References section:

    MicroRNA-mediated conversion of human fibroblasts to neurons. Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer C, Dolmetsch RE, Tsien RW, Crabtree GR. Nature. 2011 Jul 13. doi: 10.1038/nature10323. 10.1038/nature10323 PubMed 21753754