Skip to main content
Addgene

pMito-LSSmKate2-N1
(Plasmid #31879)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31879 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4646
  • Modifications to backbone
    LSS-mKate2 insert
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human cytochrome C oxidase subunit VIII
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    95
  • Mutation
    K69Y/P131T/S148G/M167D/T183S/M196V compared to mKate but numbering is relative to EGFP.
  • Entrez Gene
    COX8A (a.k.a. COX, COX8, COX8-2, COX8L, MC4DN15, VIII, VIII-L)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ggtaggcgtgtacggtgggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMito-LSSmKate2-N1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31879 ; http://n2t.net/addgene:31879 ; RRID:Addgene_31879)
  • For your References section:

    Monomeric red fluorescent proteins with a large Stokes shift. Piatkevich KD, Hulit J, Subach OM, Wu B, Abdulla A, Segall JE, Verkhusha VV. Proc Natl Acad Sci U S A. 2010 Mar 23;107(12):5369-74. Epub 2010 Mar 8. 10.1073/pnas.0914365107 PubMed 20212155