-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepN1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePSmOrange
-
Insert Size (bp)711
-
MutationS21T, Q63L, F100Y, L125M, K166R, P192S in PSmOrange (mutations are relative to mOrange but numbering is relative to EGFP)
-
Tag
/ Fusion Protein
- H2B (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer We used 3' sequencing primer
- 3′ sequencing primer gttcagggggaggtgtgggagg
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is a V119I amino acid change in Addgene's quality control sequence for H2B. It does not alter the function of this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pH2B-PSmOrange was a gift from Vladislav Verkhusha (Addgene plasmid # 31920 ; http://n2t.net/addgene:31920 ; RRID:Addgene_31920) -
For your References section:
A photoswitchable orange-to-far-red fluorescent protein, PSmOrange. Subach OM, Patterson GH, Ting LM, Wang Y, Condeelis JS, Verkhusha VV. Nat Methods. 2011 Jul 31;8(9):771-7. doi: 10.1038/nmeth.1664. 10.1038/nmeth.1664 PubMed 21804536