-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31947 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5553
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePATagRFP
-
Alt namephotoactivatable dark-to-red TagRFP red fluorescent protein
-
Insert Size (bp)714
-
MutationR69S/F84W/Q139K/A147P/N148S/M151K/Y153K/S165V/H203R/R207I/V218W/C229S compared to TagRFP (but numbering relative to EGFP)
- Promoter CMV
-
Tag
/ Fusion Protein
- VSVG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer cggtaggcgtgtacggtgggag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this construct was used in the original publication for localization studies and not for producing virus.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVSVG-PATagRFP was a gift from Vladislav Verkhusha (Addgene plasmid # 31947 ; http://n2t.net/addgene:31947 ; RRID:Addgene_31947) -
For your References section:
Bright monomeric photoactivatable red fluorescent protein for two-color super-resolution sptPALM of live cells. Subach FV, Patterson GH, Renz M, Lippincott-Schwartz J, Verkhusha VV. J Am Chem Soc. 2010 May 12;132(18):6481-91. 10.1021/ja100906g PubMed 20394363