pLKO.shNkx2-1
(Plasmid
#32400)
-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO
-
Modifications to backboneTo knockdown Nkx2-1 shRNA pLKO.1 lentiviral vectors from TRC targeting Nkx2-1 were used. The best hairpin sequence targeting Nkx2-1 was: shNkx2-1 (TRCN0000086266) 5’ CGCCATGTCTTGTTCTACCTT 3’.
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA targetting Nkx2-1
-
gRNA/shRNA sequenceCGCCATGTCTTGTTCTACCTT
-
SpeciesM. musculus (mouse)
-
Entrez GeneNkx2-1 (a.k.a. Nkx2.1, T/EBP, Titf1, Ttf-1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.shNkx2-1 was a gift from Tyler Jacks & Monte Winslow (Addgene plasmid # 32400 ; http://n2t.net/addgene:32400 ; RRID:Addgene_32400) -
For your References section:
Suppression of lung adenocarcinoma progression by Nkx2-1. Winslow MM, Dayton TL, Verhaak RG, Kim-Kiselak C, Snyder EL, Feldser DM, Hubbard DD, DuPage MJ, Whittaker CA, Hoersch S, Yoon S, Crowley D, Bronson RT, Chiang DY, Meyerson M, Jacks T. Nature. 2011 May 5. 473(7345):101-4. 10.1038/nature09881 PubMed 21471965