Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Cyclin D1 shRNA-B
(Plasmid #32494)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32494 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMKO.1
  • Backbone size w/o insert (bp) 6700
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cyclin D1
  • gRNA/shRNA sequence
    CCACAGATGTGAAGTTCATTT
  • Species
    H. sapiens (human)
  • Entrez Gene
    CCND1 (a.k.a. BCL1, D11S287E, PRAD1, U21B31)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (unknown if destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer pLXSN 5'
  • 3′ sequencing primer none
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cyclin D1 shRNA-B was a gift from Peter Sicinski (Addgene plasmid # 32494 ; http://n2t.net/addgene:32494 ; RRID:Addgene_32494)
  • For your References section:

    A function for cyclin D1 in DNA repair uncovered by protein interactome analyses in human cancers. Jirawatnotai S, Hu Y, Michowski W, Elias JE, Becks L, Bienvenu F, Zagozdzon A, Goswami T, Wang YE, Clark AB, Kunkel TA, van Harn T, Xia B, Correll M, Quackenbush J, Livingston DM, Gygi SP, Sicinski P. Nature. 2011 Jun 8;474(7350):230-4. doi: 10.1038/nature10155. 10.1038/nature10155 PubMed 21654808