-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32494 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMKO.1
- Backbone size w/o insert (bp) 6700
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCyclin D1
-
gRNA/shRNA sequenceCCACAGATGTGAAGTTCATTT
-
SpeciesH. sapiens (human)
-
Entrez GeneCCND1 (a.k.a. BCL1, D11S287E, PRAD1, U21B31)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site None (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer pLXSN 5'
- 3′ sequencing primer none (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cyclin D1 shRNA-B was a gift from Peter Sicinski (Addgene plasmid # 32494 ; http://n2t.net/addgene:32494 ; RRID:Addgene_32494) -
For your References section:
A function for cyclin D1 in DNA repair uncovered by protein interactome analyses in human cancers. Jirawatnotai S, Hu Y, Michowski W, Elias JE, Becks L, Bienvenu F, Zagozdzon A, Goswami T, Wang YE, Clark AB, Kunkel TA, van Harn T, Xia B, Correll M, Quackenbush J, Livingston DM, Gygi SP, Sicinski P. Nature. 2011 Jun 8;474(7350):230-4. doi: 10.1038/nature10155. 10.1038/nature10155 PubMed 21654808