Skip to main content

pLKO.1-OSBP
(Plasmid #32495)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32495 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    Sabatini Lab
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OSBP
  • gRNA/shRNA sequence
    GGCAAACACTCCTGGCAATGT
  • Species
    H. sapiens (human)
  • Entrez Gene
    OSBP (a.k.a. OSBP1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site None (unknown if destroyed)
  • 3′ cloning site None (unknown if destroyed)
  • 5′ sequencing primer LKO.1 (GACTATCATATGCTTACCGT)
  • 3′ sequencing primer none
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-OSBP was a gift from Alex Toker (Addgene plasmid # 32495 ; http://n2t.net/addgene:32495 ; RRID:Addgene_32495)
  • For your References section:

    Regulation of oxysterol-binding protein Golgi localization through protein kinase D-mediated phosphorylation. Nhek S, Ngo M, Yang X, Ng MM, Field SJ, Asara JM, Ridgway ND, Toker A. Mol Biol Cell. 2010 Jul 1;21(13):2327-37. Epub 2010 May 5. 10.1091/mbc.e10-02-0090 PubMed 20444975