pLKO.1-OSBP
(Plasmid
#32495)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32495 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerSabatini Lab
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOSBP
-
gRNA/shRNA sequenceGGCAAACACTCCTGGCAATGT
-
SpeciesH. sapiens (human)
-
Entrez GeneOSBP (a.k.a. OSBP1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site None (unknown if destroyed)
- 3′ cloning site None (unknown if destroyed)
- 5′ sequencing primer LKO.1 (GACTATCATATGCTTACCGT)
- 3′ sequencing primer none (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-OSBP was a gift from Alex Toker (Addgene plasmid # 32495 ; http://n2t.net/addgene:32495 ; RRID:Addgene_32495) -
For your References section:
Regulation of oxysterol-binding protein Golgi localization through protein kinase D-mediated phosphorylation. Nhek S, Ngo M, Yang X, Ng MM, Field SJ, Asara JM, Ridgway ND, Toker A. Mol Biol Cell. 2010 Jul 1;21(13):2327-37. Epub 2010 May 5. 10.1091/mbc.e10-02-0090 PubMed 20444975