This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #59549)

Full plasmid sequence is not available for this item.

Item Catalog # Description Quantity Price (USD)
Plasmid 59549 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 5802
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    DH5alpha for propagation of the plasmid. Bl21[DE3] or similar required for protein expression.
  • Copy number

  • Gene/Insert name
    Core Traptavidin-E6
  • Alt name
  • Species
    E. Coli
  • Insert Size (bp)
  • Promoter T7
  • Tag / Fusion Protein
    • E6 tag (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Traptavidin-E6 was a gift from Mark Howarth (Addgene plasmid # 59549)
  • For your References section:

    SpyAvidin hubs enable precise and ultrastable orthogonal nanoassembly. Fairhead M, Veggiani G, Lever M, Yan J, Mesner D, Robinson CV, Dushek O, van der Merwe PA, Howarth M. J Am Chem Soc. 2014 Sep 3;136(35):12355-63. doi: 10.1021/ja505584f. Epub 2014 Aug 21. 10.1021/ja505584f PubMed 25111182