Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Dead Streptavidin-SpyTag
(Plasmid #59548)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59548 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET21a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 5844
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha for propagation of the plasmid. Bl21[DE3] or similar required for protein expression.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Dead Streptavidin-SpyTag
  • Alt name
    DTag
  • Species
    E.Coli
  • Insert Size (bp)
    444
  • Mutation
    The construct lacks final K of SpyTag
  • Promoter T7
  • Tag / Fusion Protein
    • SpyTag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Dead Streptavidin-SpyTag was a gift from Mark Howarth (Addgene plasmid # 59548 ; http://n2t.net/addgene:59548 ; RRID:Addgene_59548)
  • For your References section:

    SpyAvidin hubs enable precise and ultrastable orthogonal nanoassembly. Fairhead M, Veggiani G, Lever M, Yan J, Mesner D, Robinson CV, Dushek O, van der Merwe PA, Howarth M. J Am Chem Soc. 2014 Sep 3;136(35):12355-63. doi: 10.1021/ja505584f. Epub 2014 Aug 21. 10.1021/ja505584f PubMed 25111182