pACBB-TetT-LVA
(Plasmid
#32555)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepACBB
-
Backbone manufacturerSchmidt-Dannert Lab
- Backbone size w/o insert (bp) 3110
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetR
-
Insert Size (bp)668
- Promoter Consitutive lac
-
Tag
/ Fusion Protein
- LVA tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site bglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer pBBinF (CATCCTGAACTTATCTAGACC)
- 3′ sequencing primer pBBinR (GCAGGTCCTGAAGTTAACTAG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACBB-TetT-LVA was a gift from Claudia Schmidt-dannert (Addgene plasmid # 32555 ; http://n2t.net/addgene:32555 ; RRID:Addgene_32555) -
For your References section:
Optimized compatible set of BioBrick vectors for metabolic pathway engineering. Vick JE, Johnson ET, Choudhary S, Bloch SE, Lopez-Gallego F, Srivastava P, Tikh IB, Wawrzyn GT, Schmidt-Dannert C. Appl Microbiol Biotechnol. 2011 Dec;92(6):1275-86. Epub 2011 Oct 28. 10.1007/s00253-011-3633-4 PubMed 22033566