-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32569 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTYF
- Backbone size w/o insert (bp) 7469
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameEGFP
-
Insert Size (bp)798
- Promoter 2TPH
Cloning Information for Gene/Insert 1
- Cloning method TOPO Cloning
- 5′ sequencing primer atggtgagcaagggcgaggagc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGal4p65
-
Insert Size (bp)1062
- Promoter 2TPH
Cloning Information for Gene/Insert 2
- Cloning method TOPO Cloning
- 5′ sequencing primer atgaagctactgtcttctatcgaac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid grows quite slowly. Please allow up to two days for growth.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTYF-G4BS-2TPH-EGFP-IRES-GAL4p65 was a gift from Sergey Kasparov (Addgene plasmid # 32569 ; http://n2t.net/addgene:32569 ; RRID:Addgene_32569) -
For your References section:
Targeting central serotonergic neurons with lentiviral vectors based on a transcriptional amplification strategy. Benzekhroufa K, Liu BH, Teschemacher AG, Kasparov S. Gene Ther. 2009 May;16(5):681-8. Epub 2009 Feb 12. 10.1038/gt.2009.7 PubMed 19212426