pTYF-3.6TPH-GAL4p65
(Plasmid
#32571)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTYF
- Backbone size w/o insert (bp) 7469
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGal4p65
-
SpeciesM. musculus (mouse), S. cerevisiae (budding yeast)
-
Insert Size (bp)1062
- Promoter 3.6TPH
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer atgaagctactgtcttctatcgaac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTYF-3.6TPH-GAL4p65 was a gift from Sergey Kasparov (Addgene plasmid # 32571 ; http://n2t.net/addgene:32571 ; RRID:Addgene_32571) -
For your References section:
Targeting central serotonergic neurons with lentiviral vectors based on a transcriptional amplification strategy. Benzekhroufa K, Liu BH, Teschemacher AG, Kasparov S. Gene Ther. 2009 May;16(5):681-8. Epub 2009 Feb 12. 10.1038/gt.2009.7 PubMed 19212426