Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

TRE-KRAB-dCas9-IRES-BFP
(Plasmid #85449)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85449 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHR
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 8812
  • Total vector size (bp) 14609
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    BFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRAB-dCas9-IRES-BFP
  • Species
    Synthetic
  • Insert Size (bp)
    5797
  • Promoter TRE3G
  • Tags / Fusion Proteins
    • KRAB domain (N terminal on insert)
    • HA Tag (C terminal on insert)
    • 2x NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer pHR-F TTACAGGGACAGCAGAGATC
  • 3′ sequencing primer WPRE-R CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRE-KRAB-dCas9-IRES-BFP was a gift from Eric Lander (Addgene plasmid # 85449 ; http://n2t.net/addgene:85449 ; RRID:Addgene_85449)
  • For your References section:

    Systematic mapping of functional enhancer-promoter connections with CRISPR interference. Fulco CP, Munschauer M, Anyoha R, Munson G, Grossman SR, Perez EM, Kane M, Cleary B, Lander ES, Engreitz JM. Science. 2016 Sep 29. pii: aag2445. 10.1126/science.aag2445 PubMed 27708057