Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #32572)


Item Catalog # Description Quantity Price (USD)
Plasmid 32572 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7076
  • Vector type
    Mammalian Expression, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter 3.6TPH

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer atggtgagcaagggcgaggagctg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that Addgene's quality control sequence shows A inserted relative to the author's sequence. There is no evidence that this insertion affects the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pXcX-G4BS-3.6TPH-EGFP was a gift from Sergey Kasparov (Addgene plasmid # 32572 ; ; RRID:Addgene_32572)
  • For your References section:

    Adenoviral vectors for highly selective gene expression in central serotonergic neurons reveal quantal characteristics of serotonin release in the rat brain. Benzekhroufa K, Liu B, Tang F, Teschemacher AG, Kasparov S. BMC Biotechnol. 2009 Mar 19;9:23. 10.1186/1472-6750-9-23 PubMed 19298646