-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 32704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV
-
Backbone manufacturerRichard O. Hynes group
-
Modifications to backbone1) GFP to dsRed 2) Thy1.1-mir30 to emGFP-miR (Invitrogen)
-
Vector typeMammalian Expression, Retroviral, RNAi, Cre/Lox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsThe depositor notes that XL1-Blue is also ok for general purpose use.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameemGFP-miRNA
-
gRNA/shRNA sequenceIt is a vector for cloning new miRNA.
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCCCACAACGAGGACTACAC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-FLIP-puro-dsRed-GFP-miRNA was a gift from Hans Clevers (Addgene plasmid # 32704 ; http://n2t.net/addgene:32704 ; RRID:Addgene_32704) -
For your References section:
Controlled gene expression in primary Lgr5 organoid cultures. Koo BK, Stange DE, Sato T, Karthaus W, Farin HF, Huch M, van Es JH, Clevers H. Nat Methods. 2011 Dec 4. doi: 10.1038/nmeth.1802. 10.1038/nmeth.1802 PubMed 22138822