pCol-TGM-luc.1309
(Plasmid
#32720)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBS31'-RBGpA
-
Backbone manufacturerJaensich laboratory
- Backbone size w/o insert (bp) 6120
-
Modifications to backboneGFP-miR30 cassette addition Xho mutation
-
Vector typeMouse Targeting, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10/P3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameluciferase
-
gRNA/shRNA sequencectcgagaaggtatattgctgttgacagtgagcgcccgcctgaagtctctgattaatagt gaagccacagatgtattaatcagagacttcaggcggttgcctactgcctcggaattc
- Promoter Tre
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer EGFP-C
- 3′ sequencing primer Bglob-intron-R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCol-TGM-luc.1309 was a gift from Scott Lowe (Addgene plasmid # 32720 ; http://n2t.net/addgene:32720 ; RRID:Addgene_32720) -
For your References section:
A rapid and scalable system for studying gene function in mice using conditional RNA interference. Premsrirut PK, Dow LE, Kim SY, Camiolo M, Malone CD, Miething C, Scuoppo C, Zuber J, Dickins RA, Kogan SC, Shroyer KR, Sordella R, Hannon GJ, Lowe SW. Cell. 2011 Apr 1;145(1):145-58. 10.1016/j.cell.2011.03.012 PubMed 21458673