Skip to main content

pCol-TGM-luc.1309
(Plasmid #32720)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32720 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBS31'-RBGpA
  • Backbone manufacturer
    Jaensich laboratory
  • Backbone size w/o insert (bp) 6120
  • Modifications to backbone
    GFP-miR30 cassette addition Xho mutation
  • Vector type
    Mouse Targeting, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10/P3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    luciferase
  • gRNA/shRNA sequence
    ctcgagaaggtatattgctgttgacagtgagcgcccgcctgaagtctctgattaatagt gaagccacagatgtattaatcagagacttcaggcggttgcctactgcctcggaattc
  • Promoter Tre

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer EGFP-C
  • 3′ sequencing primer Bglob-intron-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCol-TGM-luc.1309 was a gift from Scott Lowe (Addgene plasmid # 32720 ; http://n2t.net/addgene:32720 ; RRID:Addgene_32720)
  • For your References section:

    A rapid and scalable system for studying gene function in mice using conditional RNA interference. Premsrirut PK, Dow LE, Kim SY, Camiolo M, Malone CD, Miething C, Scuoppo C, Zuber J, Dickins RA, Kogan SC, Shroyer KR, Sordella R, Hannon GJ, Lowe SW. Cell. 2011 Apr 1;145(1):145-58. 10.1016/j.cell.2011.03.012 PubMed 21458673