-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32937 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEntr3c
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2700
-
Modifications to backbonesee pEntr-flbio
-
Vector typeGateway Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGATA4
-
Alt nameGATA-4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1500
-
Entrez GeneGata4 (a.k.a. Gata-4)
- Promoter none
-
Tag
/ Fusion Protein
- flag-bio (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer GGCATCAAACTAAGCAGAAG
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEntr-GATA4flbio was a gift from William Pu (Addgene plasmid # 32937 ; http://n2t.net/addgene:32937 ; RRID:Addgene_32937) -
For your References section:
Co-occupancy by multiple cardiac transcription factors identifies transcriptional enhancers active in heart. He A, Kong SW, Ma Q, Pu WT. Proc Natl Acad Sci U S A. 2011 Apr 5. 108(14):5632-7. 10.1073/pnas.1016959108 PubMed 21415370