Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pEntr-GATA4flbio
(Plasmid #32937)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32937 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEntr3c
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2700
  • Modifications to backbone
    see pEntr-flbio
  • Vector type
    gateway

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GATA4
  • Alt name
    GATA-4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1500
  • Entrez Gene
    Gata4 (a.k.a. Gata-4)
  • Promoter none
  • Tag / Fusion Protein
    • flag-bio (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer GGCATCAAACTAAGCAGAAG
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEntr-GATA4flbio was a gift from William Pu (Addgene plasmid # 32937 ; http://n2t.net/addgene:32937 ; RRID:Addgene_32937)
  • For your References section:

    Co-occupancy by multiple cardiac transcription factors identifies transcriptional enhancers active in heart. He A, Kong SW, Ma Q, Pu WT. Proc Natl Acad Sci U S A. 2011 Apr 5. 108(14):5632-7. 10.1073/pnas.1016959108 PubMed 21415370