-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep3XFlag-CMV10
-
Backbone manufacturerSigma
- Backbone size w/o insert (bp) 6307
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMcl-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)995
-
Entrez GeneMcl1 (a.k.a. Gm52627, Mcl-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3XFlag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer acaaagaccatgacggtgat
- 3′ sequencing primer ccaggagaggcactggggag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3XFlag-CMV10-Flag-mMcl-1 was a gift from Joseph Opferman (Addgene plasmid # 32978 ; http://n2t.net/addgene:32978 ; RRID:Addgene_32978) -
For your References section:
Ubiquitin-independent degradation of antiapoptotic MCL-1. Stewart DP, Koss B, Bathina M, Perciavalle RM, Bisanz K, Opferman JT. Mol Cell Biol. 2010 Jun;30(12):3099-110. Epub 2010 Apr 12. 10.1128/MCB.01266-09 PubMed 20385764