Skip to main content
Addgene

POPTOP
(Plasmid #34848)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 34848 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJIM20
  • Backbone size w/o insert (bp) 8000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TCF binding sites
  • Insert Size (bp)
    70
  • Mutation
    The TCF binding site is: AGATCAAAGG
  • Promoter pes-10 minimal promoter
  • Tags / Fusion Proteins
    • mCherry (C terminal on backbone)
    • let-858 3'UTR (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (unknown if destroyed)
  • 3′ cloning site AvrII (unknown if destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer EGFP-N, T3
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Seven copies of the TCF binding site, AGATCAAAGG, were transferred from Super8XTOPflash (plasmid M50) (Veeman et al., 2003) into Fire lab vector L3135 to place them downstream of the pes-10 minimal promoter. The seven TCF sites and the pes-10 minimal promoter were amplified using forward primer AAGCTTGGTACCGAGCTCGG and reverse primer ATGCCTAGGCAATCAATGCCTGAAAGTTAAAAATTAC. The product was then cloned into mCherry plasmid (PJIM20) with let-858 3’ UTR (kind gift from Jon Audhya) using sites SpeI and AvrII.

There is a known sequence discrepancy between the depositor's and Addgene's sequence, which does not alter the function of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    POPTOP was a gift from Paul Sternberg (Addgene plasmid # 34848 ; http://n2t.net/addgene:34848 ; RRID:Addgene_34848)
  • For your References section:

    Opposing Wnt pathways orient cell polarity during organogenesis. Green JL, Inoue T, Sternberg PW. Cell. 2008 Aug 22;134(4):646-56. 10.1016/j.cell.2008.06.026 PubMed 18724937