Skip to main content

pCFJ421 - Pmyo-2::GFP::H2B (pharynx)
(Plasmid #34876)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 34876 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDESTR4-R3
  • Vector type
    Worm targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10/P3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pmyo-2 GFP H2B tbb-2 UTR
  • Species
    C. elegans (nematode)
  • Mutation
    S65C
  • Promoter myo-2

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LacZ-F2 (5'-cctcttcgctattacgccag-3')
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFJ421 - Pmyo-2::GFP::H2B (pharynx) was a gift from Erik Jorgensen (Addgene plasmid # 34876 ; http://n2t.net/addgene:34876 ; RRID:Addgene_34876)
  • For your References section:

    Improved Mos1-mediated transgenesis in C. elegans. Frokjaer-Jensen C, Davis MW, Ailion M, Jorgensen EM. Nat Methods. 2012 Jan 30;9(2):117-8. doi: 10.1038/nmeth.1865. 10.1038/nmeth.1865 PubMed 22290181