-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 34902 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMSCV-P C-FlagHA
- Backbone size w/o insert (bp) 8700
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGLTSCR1
-
SpeciesH. sapiens (human)
-
Entrez GeneBICRA (a.k.a. GLTSCR1)
- Promoter MSCV LTR
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer 5' CTACATCGTGACCTGGGAAGC 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The GLTSCR sequence matches GenBank: AAI56273.1 and is considered a partial sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p6622 MSCV-P C HA GLTSCR was a gift from Peter Howley (Addgene plasmid # 34902 ; http://n2t.net/addgene:34902 ; RRID:Addgene_34902) -
For your References section:
Systematic identification of interactions between host cell proteins and E7 oncoproteins from diverse human papillomaviruses. White EA, Sowa ME, Tan MJ, Jeudy S, Hayes SD, Santha S, Munger K, Harper JW, Howley PM. Proc Natl Acad Sci U S A. 2012 Jan 9. 10.1073/pnas.1116776109 PubMed 22232672