-
PurposeExpresses a fusion between the Lck domain and cytosolic GCaMP5G. This construct targets GCaMP5G to the plasma membrane
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3950
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLck-GCaMP5G
-
Alt nameLck-GCaMP3-T302L R303P D380Y
-
Insert Size (bp)1470
-
MutationPlasmid contains N-terminal 26 amino acid membrane targeting sequence of Lck (Src tyrosine kinase) fused to GCaMP5G (GCaMP3-T302L R303P D380Y).
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACGGTGGGAGGTCTATATAAGCAG AG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLck-GCaMP5G was created using Lck-GCaMP3 (http://www.addgene.org/26974/) described previously by the Khakh lab, and cytosolic GCaMP5G provided by the Kim lab (http://www.addgene.org/31788)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lck-GCaMP5G is a fusion between the Lck domain (https://www.ncbi.nlm.nih.gov/pubmed/21205365) and cytosolic GCaMP5G (http://www.addgene.org/31788) This construct targets GCaMP5G to the plasma membrane.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN1 Lck-GCaMP5G was a gift from Baljit Khakh (Addgene plasmid # 34924 ; http://n2t.net/addgene:34924 ; RRID:Addgene_34924) -
For your References section:
Optimization of a GCaMP calcium indicator for neural activity imaging. Akerboom J, Chen TW, Wardill TJ, Tian L, Marvin JS, Mutlu S, Calderon NC, Esposti F, Borghuis BG, Sun XR, Gordus A, Orger MB, Portugues R, Engert F, Macklin JJ, Filosa A, Aggarwal A, Kerr RA, Takagi R, Kracun S, Shigetomi E, Khakh BS, Baier H, Lagnado L, Wang SS, Bargmann CI, Kimmel BE, Jayaraman V, Svoboda K, Kim DS, Schreiter ER, Looger LL. J Neurosci. 2012 Oct 3;32(40):13819-40. doi: 10.1523/JNEUROSCI.2601-12.2012. 10.1523/JNEUROSCI.2601-12.2012 PubMed 23035093