-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35002 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCCL-cppt-PGK-WPRE
-
Backbone manufacturerMalin Parmar
- Backbone size w/o insert (bp) 7041
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePaired box protein Pax-2
-
Alt namePax2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1251
-
GenBank IDNT_039687.7
-
Entrez GenePax2 (a.k.a. Opdc, Pax-2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ACTCCCAGAGTGGTGTGGAC
- 3′ sequencing primer GACGCTCAAAGACTCGATCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pax2 was a gift from Malin Parmar (Addgene plasmid # 35002 ; http://n2t.net/addgene:35002 ; RRID:Addgene_35002) -
For your References section:
Direct conversion of human fibroblasts to dopaminergic neurons. Pfisterer U, Kirkeby A, Torper O, Wood J, Nelander J, Dufour A, Bjorklund A, Lindvall O, Jakobsson J, Parmar M. Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6. 10.1073/pnas.1105135108 PubMed 21646515