pSSA-1-3
(Plasmid
#35091)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 35091 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3-control
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5256
-
Modifications to backboneLuciferase gene is split into two inactive fragments containing overlapping homologies with a ZFN site between them. In cells, cleavage at the ZFN site will initiate single strand annealing and generate an active luciferase gene.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSplit luciferase for GZF1/3 SSA assay
-
Alt nameFirefly luciferase
-
Insert Size (bp)906
-
MutationSingle strand annealing (SSA) recombinaion reporter assay containing target site for GZF1/3 zinc finger nuclease
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer LucRep-f: CGAAGGTTGTGGATCTGGATACC
- 3′ sequencing primer LucRep-r: TAGCTGATGTAGTCTCAGTGAGC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Originally described in Szczepek, M., Brondani, V., Büchel, J., Serrano, L., Segal, D.J. and Cathomen, T. (2007) Structure-based redesign of the dimerization interface reduces the toxicity of zinc finger nucleases. Nat. Biotechnol., 25:786-793.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSSA-1-3 was a gift from David Segal (Addgene plasmid # 35091 ; http://n2t.net/addgene:35091 ; RRID:Addgene_35091) -
For your References section:
The generation of zinc finger proteins by modular assembly. Bhakta MS, Segal DJ. Methods Mol Biol. 2010;649:3-30. 10.1007/978-1-60761-753-2_1 PubMed 20680825