Skip to main content

pPGK-GZF3-DD
(Plasmid #35093)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 35093 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPGK
  • Backbone size w/o insert (bp) 4500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZFN GZF3-Fok(DD)
  • Species
    synthetic
  • Insert Size (bp)
    1000
  • Mutation
    contains the "DD" obligate heterodimer variant
  • Promoter PGK
  • Tags / Fusion Proteins
    • HA (N terminal on insert)
    • SV40 NLS (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer HAtag-f: ATGTACCCATACGATGTCCCAGACTACG
  • 3′ sequencing primer FokLinkSeq-r: TCTATCCTGAGTGGAATTTCTGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Originally described in Szczepek, M., Brondani, V., Büchel, J., Serrano, L., Segal, D.J. and Cathomen, T. (2007) Structure-based redesign of the dimerization interface reduces the toxicity of zinc finger nucleases. Nat. Biotechnol., 25:786-793.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPGK-GZF3-DD was a gift from David Segal (Addgene plasmid # 35093 ; http://n2t.net/addgene:35093 ; RRID:Addgene_35093)
  • For your References section:

    The generation of zinc finger proteins by modular assembly. Bhakta MS, Segal DJ. Methods Mol Biol. 2010;649:3-30. 10.1007/978-1-60761-753-2_1 PubMed 20680825