pPGK-empty
(Plasmid
#35094)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 35094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPGK
- Backbone size w/o insert (bp) 4500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedeletion of zinc fingers and nuclease
-
Speciessynthetic
-
Insert Size (bp)540
-
Mutationuse as a transfection balance for pPGK-ZFN plasmids
- Promoter PGK
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer HAtag-f: ATGTACCCATACGATGTCCCAGACTACG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Originally described in Szczepek, M., Brondani, V., Büchel, J., Serrano, L., Segal, D.J. and Cathomen, T. (2007) Structure-based redesign of the dimerization interface reduces the toxicity of zinc finger nucleases. Nat. Biotechnol., 25:786-793.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPGK-empty was a gift from David Segal (Addgene plasmid # 35094 ; http://n2t.net/addgene:35094 ; RRID:Addgene_35094) -
For your References section:
The generation of zinc finger proteins by modular assembly. Bhakta MS, Segal DJ. Methods Mol Biol. 2010;649:3-30. 10.1007/978-1-60761-753-2_1 PubMed 20680825