pWPI-FLAG-hPRKCI
(Plasmid
#35387)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 35387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepWPI
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 11076
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProtein Kinase C iota
-
Alt namePRKCI
-
Alt nameatypical Protein Kinase C
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1820
-
GenBank IDBAG70257.1
-
Entrez GenePRKCI (a.k.a. DXS1179E, PKCI, nPKC-iota)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (destroyed during cloning)
- 3′ cloning site PmeI (destroyed during cloning)
- 5′ sequencing primer ACTGGAATCCACCATGGAAC
- 3′ sequencing primer AAGAATGTGTCTGACAGCTG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the vector backbone, pWPI, is a bicistronic vector that allows for simultaneous expression of a transgene (PRKCI in this case) and an EGFP marker to facilitate tracking of transduced cells. The EGFP marker cDNA has been inserted downstream of EMCV IRES.
The PRKCI insert in this plasmid is a known variant that lack the first nine amino acids of PRKCI when compared to GenBank entry NP_002731.4
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWPI-FLAG-hPRKCI was a gift from Luke McCaffrey (Addgene plasmid # 35387 ; http://n2t.net/addgene:35387 ; RRID:Addgene_35387)