Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-CaMKIIa-hChR2(C128S/D156A)-EYFP
(Plasmid #35501)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35501 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5385
  • Modifications to backbone
    Addition of a CaMKIIa promoter and a WPRE
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hChR2
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
    1661
  • Mutation
    C128S and D156A
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGTCCTGCAGTATTGTGTAT
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ChR2 variant harboring two amino acid substitutions which act to stabilize the conducting state of the channel to deactivate with a time constant of nearly 30 minutes following a brief pulse of activating blue light. Like previously published step function opsins, this stabilized step function opsin (SSFO) may be deactivated using yellow light (590nm). The stabilized open state of the channel allows for both lower power activation, meaning in some circumstances the light delivery system need not penetrate the brain, as well as for behavior in the absence of a tethered laser or other light delivery system.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-hChR2(C128S/D156A)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 35501 ; http://n2t.net/addgene:35501 ; RRID:Addgene_35501)
  • For your References section:

    Neocortical excitation/inhibition balance in information processing and social dysfunction. Yizhar O, Fenno LE, Prigge M, Schneider F, Davidson TJ, O'Shea DJ, Sohal VS, Goshen I, Finkelstein J, Paz JT, Stehfest K, Fudim R, Ramakrishnan C, Huguenard JR, Hegemann P, Deisseroth K. Nature. 2011 Jul 27;477(7363):171-8. doi: 10.1038/nature10360. 10.1038/nature10360 PubMed 21796121