pRNA-U6-Zip let-7
(Plasmid
#35670)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35670 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRNA-U6.1/Neo-siFluc
-
Backbone manufacturerGenscript
- Backbone size w/o insert (bp) 5124
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelet-7Zip
-
SpeciesSynthetic
-
Insert Size (bp)397
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR I (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer gagggcctatttcccatgat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there is a 1bp deletion in Addgene's quality control sequence when compared to depositor's reference sequence. This deletion will not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRNA-U6-Zip let-7 was a gift from Phillip Zamore (Addgene plasmid # 35670 ; http://n2t.net/addgene:35670 ; RRID:Addgene_35670)