pT7-7 asyn S129A
(Plasmid
#36048)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36048 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT7-7
- Backbone size w/o insert (bp) 2438
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namealpha-synuclein S129A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)476
-
MutationS129A
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer AmpStop (TCAGGCAACTATGGATGAAC)
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lashuel Lab Plasmid #189
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-7 asyn S129A was a gift from Hilal Lashuel (Addgene plasmid # 36048 ; http://n2t.net/addgene:36048 ; RRID:Addgene_36048) -
For your References section:
Phosphorylation at Ser-129 but not the phosphomimics S129E/D inhibits the fibrillation of alpha-synuclein. Paleologou KE, Schmid AW, Rospigliosi CC, Kim HY, Lamberto GR, Fredenburg RA, Lansbury PT Jr, Fernandez CO, Eliezer D, Zweckstetter M, Lashuel HA. J Biol Chem. 2008 Jun 13;283(24):16895-905. Epub 2008 Mar 14. 10.1074/jbc.M800747200 PubMed 18343814