Skip to main content

pFZ19
(Plasmid #36184)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36184 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Modifications to backbone
    Estrogen inducible promoter system, Gateway compatible. Hygromycin resistance in plants.
  • Vector type
    Plant Expression ; plant T-DNA vector
  • Promoter XVE_35S (estrogen-inducible)
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Kanamycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Copy number
    High Copy

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer catttggagaggacacgctggg
  • 3′ sequencing primer gctaacatctctgggaattccgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFZ19 was a gift from Daniel Voytas (Addgene plasmid # 36184 ; http://n2t.net/addgene:36184 ; RRID:Addgene_36184)
  • For your References section:

    High frequency targeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases. Zhang F, Maeder ML, Unger-Wallace E, Hoshaw JP, Reyon D, Christian M, Li X, Pierick CJ, Dobbs D, Peterson T, Joung JK, Voytas DF. Proc Natl Acad Sci U S A. 2010 Jun 29. 107(26):12028-33. 10.1073/pnas.0914991107 PubMed 20508152