-
Purpose(Empty Backbone) Expression of genes under control of an estrogen-inducible 35S promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36184 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneunknown
-
Modifications to backboneEstrogen inducible promoter system, Gateway compatible. Hygromycin resistance in plants.
-
Vector typePlant Expression ; plant T-DNA vector
- Promoter XVE_35S (estrogen-inducible)
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Copy numberHigh Copy
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer catttggagaggacacgctggg
- 3′ sequencing primer gctaacatctctgggaattccgc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFZ19 was a gift from Daniel Voytas (Addgene plasmid # 36184 ; http://n2t.net/addgene:36184 ; RRID:Addgene_36184) -
For your References section:
High frequency targeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases. Zhang F, Maeder ML, Unger-Wallace E, Hoshaw JP, Reyon D, Christian M, Li X, Pierick CJ, Dobbs D, Peterson T, Joung JK, Voytas DF. Proc Natl Acad Sci U S A. 2010 Jun 29. 107(26):12028-33. 10.1073/pnas.0914991107 PubMed 20508152