pCY 3050-07
(Plasmid
#36223)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 36223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBS7
-
Backbone manufacturerYeast Resource Center, University of Washington
- Backbone size w/o insert (bp) 4882
-
Vector typeYeast cassette for PCR and homologous recombination
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5alpha used for DNA recovery of plasmid (i.e. DNA preps).
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameStreptoalloteichus hindustanus bleomycin (Sh ble)
-
SpeciesStreptoalloteichus hindustanus
-
Insert Size (bp)970
-
Tag
/ Fusion Protein
- yEpolylinker-Venus-Zeocin (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer GGTCTTGTTAGAATTTGTTACTGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypPICZ (Invitrogen)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The minor discrepancies between the Addgene and author's sequence do not affect the plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCY 3050-07 was a gift from Anne Robinson (Addgene plasmid # 36223 ; http://n2t.net/addgene:36223 ; RRID:Addgene_36223) -
For your References section:
Cassette series designed for live-cell imaging of proteins and high-resolution techniques in yeast. Young CL, Raden DL, Caplan JL, Czymmek KJ, Robinson AS. Yeast. 2012 Mar;29(3-4):119-36. doi: 10.1002/yea.2895. Epub 2012 Apr 4. 10.1002/yea.2895 PubMed 22473760