pRRL WS1.6 WASp
(Plasmid
#36250)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252
-
Backbone manufacturerDidier Trono
- Backbone size w/o insert (bp) 6857
- Total vector size (bp) 9312
-
Modifications to backbonePGK GFP removed (EcoRV and BamHI)and replaced with a multiple cloning site. WS1.6-WASp cassette cloned into MluI-SpeI site of new MCS.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameWASp
-
Alt nameWiskott-Aldrich Syndrome Protein
-
Alt nameWAS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1509
-
Entrez GeneWAS (a.k.a. IMD2, SCNX, THC, THC1, WASP, WASPA)
- Promoter WS1.6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer gatcacgagactagcctcgag
- 3′ sequencing primer caacgggccacaactcctc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBackbone is from Addgene plasmid 12252 (Didier Trono)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL WS1.6 WASp was a gift from David Rawlings (Addgene plasmid # 36250 ; http://n2t.net/addgene:36250 ; RRID:Addgene_36250) -
For your References section:
Ubiquitous high-level gene expression in hematopoietic lineages provides effective lentiviral gene therapy of murine Wiskott-Aldrich Syndrome. Astrakhan A, Sather BD, Ryu BY, Khim S, Singh S, Humblet-Baron S, Ochs HD, Miao CH, Rawlings DJ. Blood. 2012 Mar 19. 10.1182/blood-2011-03-340711 PubMed 22431569