Skip to main content

pRRL WS1.6 WASp
(Plasmid #36250)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 36250 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 6857
  • Total vector size (bp) 9312
  • Modifications to backbone
    PGK GFP removed (EcoRV and BamHI)and replaced with a multiple cloning site. WS1.6-WASp cassette cloned into MluI-SpeI site of new MCS.
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    WASp
  • Alt name
    Wiskott-Aldrich Syndrome Protein
  • Alt name
    WAS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1509
  • Entrez Gene
    WAS (a.k.a. IMD2, SCNX, THC, THC1, WASP, WASPA)
  • Promoter WS1.6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gatcacgagactagcctcgag
  • 3′ sequencing primer caacgggccacaactcctc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone is from Addgene plasmid 12252 (Didier Trono)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL WS1.6 WASp was a gift from David Rawlings (Addgene plasmid # 36250 ; http://n2t.net/addgene:36250 ; RRID:Addgene_36250)
  • For your References section:

    Ubiquitous high-level gene expression in hematopoietic lineages provides effective lentiviral gene therapy of murine Wiskott-Aldrich Syndrome. Astrakhan A, Sather BD, Ryu BY, Khim S, Singh S, Humblet-Baron S, Ochs HD, Miao CH, Rawlings DJ. Blood. 2012 Mar 19. 10.1182/blood-2011-03-340711 PubMed 22431569