Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRRL WS1.6 GFP
(Plasmid #36249)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 36249 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 6857
  • Total vector size (bp) 8524
  • Modifications to backbone
    PGK GFP removed (EcoRV and BamHI)and replaced with a multiple cloning site for addition of promoter CDS cassettes
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Alt name
    EGFP
  • Alt name
    enhanced green fluorescent protein
  • Insert Size (bp)
    720
  • Entrez Gene
    eGFP (a.k.a. pPRS3a_01)
  • Promoter WAS (human 1.6 kb)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gatcacgagactagcctcgag
  • 3′ sequencing primer caacgggccacaactcctc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL WS1.6 GFP was a gift from David Rawlings (Addgene plasmid # 36249 ; http://n2t.net/addgene:36249 ; RRID:Addgene_36249)
  • For your References section:

    Ubiquitous high-level gene expression in hematopoietic lineages provides effective lentiviral gene therapy of murine Wiskott-Aldrich Syndrome. Astrakhan A, Sather BD, Ryu BY, Khim S, Singh S, Humblet-Baron S, Ochs HD, Miao CH, Rawlings DJ. Blood. 2012 Mar 19. 10.1182/blood-2011-03-340711 PubMed 22431569