Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRRL MND GFP
(Plasmid #36247)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 36247 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252
  • Backbone manufacturer
    Didier Trono
  • Backbone size w/o insert (bp) 6857
  • Total vector size (bp) 7332
  • Modifications to backbone
    PGK GFP removed (EcoRV and BamHI)and replaced with a multiple cloning site for addition of MND GFP cassette
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP
  • Alt name
    enhanced green fluorescent protein
  • Alt name
    EGFP
  • Insert Size (bp)
    720
  • Entrez Gene
    eGFP (a.k.a. pPRS3a_01)
  • Promoter MND

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gatcacgagactagcctcgag
  • 3′ sequencing primer caacgggccacaactcctc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Backbone is from Addgene plasmid 12252 (Didier Trono)
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL MND GFP was a gift from David Rawlings (Addgene plasmid # 36247 ; http://n2t.net/addgene:36247 ; RRID:Addgene_36247)
  • For your References section:

    Ubiquitous high-level gene expression in hematopoietic lineages provides effective lentiviral gene therapy of murine Wiskott-Aldrich Syndrome. Astrakhan A, Sather BD, Ryu BY, Khim S, Singh S, Humblet-Baron S, Ochs HD, Miao CH, Rawlings DJ. Blood. 2012 Mar 19. 10.1182/blood-2011-03-340711 PubMed 22431569