-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36289 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBad
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 4100
- Total vector size (bp) 4800
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDimerization dependent RFP A1
-
Insert Size (bp)700
-
Tag
/ Fusion Protein
- His tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDDRFP-A1 was a gift from Robert Campbell (Addgene plasmid # 36289 ; http://n2t.net/addgene:36289 ; RRID:Addgene_36289) -
For your References section:
A fluorogenic red fluorescent protein heterodimer. Alford SC, Abdelfattah AS, Ding Y, Campbell RE. Chem Biol. 2012 Mar 23;19(3):353-60. 10.1016/j.chembiol.2012.01.006 PubMed 22444590