pCellulose
(Plasmid
#36300)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36300 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBiobrick family of vectors
-
Vector typeSynthetic Biology
-
Selectable markersAmp
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Growth instructionsUse Ampicillin EZ media. Promoters on this plasmid are strongly expressed in LB medium. Growth in minimal medium with glucose instead of LB, or EZ rich medium, may help with plasmid stability
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepCellulose
-
Insert Size (bp)8589
- Promoter Two promoters from the E coli genome drive two different genes: PcspD and PwrbA
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gacgtcggtgcctaatgagtg
- 3′ sequencing primer tgcctggagatccttactcgagtt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note from depositor regarding growing this plasmid: W used DH10B, plated on LB/carb, and grew the plasmid up in TB medium plus 2% glycerol and 100 ug/mL carbenicillin. It's key to not grow the cells up too long, either on the plate or in the liquid medium, and probably best to harvest the cells in early stationary phase.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCellulose was a gift from Jay Keasling (Addgene plasmid # 36300 ; http://n2t.net/addgene:36300 ; RRID:Addgene_36300) -
For your References section:
Synthesis of three advanced biofuels from ionic liquid-pretreated switchgrass using engineered Escherichia coli. Bokinsky G, Peralta-Yahya PP, George A, Holmes BM, Steen EJ, Dietrich J, Soon Lee T, Tullman-Ercek D, Voigt CA, Simmons BA, Keasling JD. Proc Natl Acad Sci U S A. 2011 Dec 13;108(50):19949-54. Epub 2011 Nov 28. 10.1073/pnas.1106958108 PubMed 22123987