pLysscys255
(Plasmid #36429)

• Depositing Labs: Emine Gunhan, Pete Lollar
• Publication: Gunhan et al Protein Expr Purif. 2008 Apr;58(2):203-9. Epub 2007 Nov 19.

Backbone

• Vector backbone: pET-11d
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5674
• Total vector size (bp): 6105
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Growth instructions: The expressed protein saporin-3 cys255 is non-toxic. The LD50 for saporin in mice is 4-8 mg/kg.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Saporin-3/cys255
• Alt name: Cys255sap-3
• Species: Saponaria officinalis
• Insert Size (bp): 786
• Mutation: cys added at position 255
• Promoter: T7

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ACGATGCGTCCGGCGTAGAGG
• 3′ sequencing primer: CAAATAGGGGTTCCGCGCAC

Resource Information

• Supplemental Documents:
  • Saporin Saftey
• A portion of this plasmid was derived from a plasmid made by: Emine Gunhan Dept of Neurobiology, Physiology, and Behavior University of California One Shields Ave 196 Briggs Hall Davis, CA 95616

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry