-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1-puro
-
Backbone manufacturerWeinberg Lab
- Backbone size w/o insert (bp) 6900
- Total vector size (bp) 6958
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSmad4
-
gRNA/shRNA sequenceCCGGGCCATAGTGAAGGACTGTTGCCTCGAGGCAACAGTCCTTCACTATGGCTTTTTG
-
SpeciesH. sapiens (human)
-
Entrez GeneSMAD4 (a.k.a. DPC4, JIP, MADH4, MYHRS)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pLKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-shSmad4 was a gift from Sam Thiagalingam (Addgene plasmid # 37046 ; http://n2t.net/addgene:37046 ; RRID:Addgene_37046) -
For your References section:
Smad signaling is required to maintain epigenetic silencing during breast cancer progression. Papageorgis P, Lambert AW, Ozturk S, Gao F, Pan H, Manne U, Alekseyev YO, Thiagalingam A, Abdolmaleky HM, Lenburg M, Thiagalingam S. Cancer Res. 2010 Feb 1;70(3):968-78. Epub 2010 Jan 19. 10.1158/0008-5472.CAN-09-1872 PubMed 20086175