Skip to main content

Lenti-Hb9-RFP
(Plasmid #37081)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 37081 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CSCspPW
  • Backbone manufacturer
    Inder Verma lab
  • Backbone size w/o insert (bp) 8466
  • Total vector size (bp) 12486
  • Modifications to backbone
    none
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Hb9 RFP
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4020
  • Promoter Hb9

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GCTAGCTCCGGAGAGCAAAAGCTG
  • 3′ sequencing primer TGTAATCCAGAGGTTGATTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Sam Pfaff
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expresses RFP under the control of the Hb9 promoter to visualize postmitotic human motor neurons

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-Hb9-RFP was a gift from Fred Gage (Addgene plasmid # 37081 ; http://n2t.net/addgene:37081 ; RRID:Addgene_37081)
  • For your References section:

    Non-cell-autonomous effect of human SOD1 G37R astrocytes on motor neurons derived from human embryonic stem cells. Marchetto MC, Muotri AR, Mu Y, Smith AM, Cezar GG, Gage FH. Cell Stem Cell. 2008 Dec 4;3(6):649-57. 10.1016/j.stem.2008.10.001 PubMed 19041781