Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSR-puro-Mff1 shRNA
(Plasmid #37247)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37247 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSuper-Retro-Puro
  • Backbone manufacturer
    OligoEngine
  • Backbone size w/o insert (bp) 6350
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mff1
  • gRNA/shRNA sequence
    AACGCTGACCTGGAACAAGGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    MFF (a.k.a. C2orf33, EMPF2, GL004)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSR-puro-Mff1 shRNA was a gift from Christopher Counter & David Kashatus (Addgene plasmid # 37247 ; http://n2t.net/addgene:37247 ; RRID:Addgene_37247)
  • For your References section:

    RALA and RALBP1 regulate mitochondrial fission at mitosis. Kashatus DF, Lim KH, Brady DC, Pershing NL, Cox AD, Counter CM. Nat Cell Biol. 2011 Aug 7;13(9):1108-15. doi: 10.1038/ncb2310. 10.1038/ncb2310 PubMed 21822277