-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBMN iHcRed
-
Backbone manufacturerGary Nolan
- Backbone size w/o insert (bp) 6940
- Total vector size (bp) 8453
-
Vector typeRetroviral
-
Selectable markersHcRed Fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameER50
-
Alt nameERLBD
-
Alt nameERS1 ligand binding domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)750
-
Mutation6 mutations, T371A, L384M, M421G, G521R, Y537S, N519S
-
GenBank IDBC128573.1
-
Entrez GeneESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)
- Promoter LTR
-
Tag
/ Fusion Protein
- HA-YFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer ATCGCAGCTTGGATACACGCC
- 3′ sequencing primer GAGAGGGGCGGAATTTACGTAGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is a G insertion at 1651 compared to the depositor's sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PBMN YFP-ER50 was a gift from Thomas Wandless (Addgene plasmid # 37261 ; http://n2t.net/addgene:37261 ; RRID:Addgene_37261) -
For your References section:
Destabilizing domains derived from the human estrogen receptor. Miyazaki Y, Imoto H, Chen LC, Wandless TJ. J Am Chem Soc. 2012 Mar 7;134(9):3942-5. Epub 2012 Feb 22. 10.1021/ja209933r PubMed 22332638