PBMN YFP-ER50
(Plasmid #37261)

• Depositing Lab: Thomas Wandless
• Publication: Miyazaki et al J Am Chem Soc. 2012 Mar 7;134(9):3942-5. Epub 2012 Feb 22.

Backbone

• Vector backbone: pBMN iHcRed
• Backbone manufacturer: Gary Nolan
• Backbone size w/o insert (bp): 6940
• Total vector size (bp): 8453
• Vector type: Retroviral
• Selectable markers: HcRed Fluorescence

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ER50
• Alt name: ERLBD
• Alt name: ERS1 ligand binding domain
• Species: H. sapiens (human)
• Insert Size (bp): 750
• Mutation: 6 mutations, T371A, L384M, M421G, G521R, Y537S, N519S
• GenBank ID: BC128573.1
• Entrez Gene: ESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)
• Promoter: LTR
• Tag / Fusion Protein:
  • HA-YFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: ATCGCAGCTTGGATACACGCC
• 3′ sequencing primer: GAGAGGGGCGGAATTTACGTAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There is a G insertion at 1651 compared to the depositor's sequence.